Dna Translation - Biology Worksheet printable pdf download

Dna Translation - Biology Worksheet

assign #____

name___________________________________per____

Translation of the code into your proteins!

use your own paper

1- (a)Arrange these in proper order and

(b) explain: amino acids, proteins and polypeptides.

2- Obtain an mRNA to Amino Acid conversion chart from your instructor, and

write the REAL NAMES for the 20 amino acids next to their abbreviations on

the chart. You may have to google.

3- Divide-up this mRNA piece to show its codons:

UCGCACGGUAAAUGG

4- List the steps in the translation process.

5- Use your “mRNA-Amino Acid” chart to find the following information:

(a) amino acids for these mRNA codes:

UGGUUUCGCAAU

(b) mRNA codes for these amino acids:

proline

methionine

valine

isoleucine

6- What is an “anti-codon?”

7- How does a tRNA molecule “know” where to put its amino acid?

8-- FPFCLD: draw the RNA Translation process using this code to start:

Note that underlined letters are introns:

GCATCGTATAGGGCATCATCGACATAC

Be sure you show all the proper codes for the mRNA’s, tRNA’s and show/name

the amino acids that match.

Dna Translation - Biology Worksheet